circad | circRNAs associated with diseases

circGFRA1/hsa_circ_005239
Gene	GFRA1	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Breast Cancer	ICD-10	Malignant neoplasm of breast (C50)
DBLink	Link to database	PMID	29037220
Experimental Method
Sample Type	Tissues	Comparison	tissue and human mammary epithelial (HME) cell lines (MCF10A and 184A1) and breast cancer cell lines (SKBR3, T47D, BT474, MCF-7, BT-483, BT-20, BT549, MDA-MB-468 and MDA-MB-231
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CCTCCGGGTTAAGAACAAGC Reverse CTGGCTGGCAGTTGGTAAAA	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
He, R, Liu, P, Xie, X, Zhou, Y, Liao, Q, Xiong, W, Li, X, Li, G, Zeng, Z, Tang, H (2017). circGFRA1 and GFRA1 act as ceRNAs in triple negative breast cancer by regulating miR-34a. J. Exp. Clin. Cancer Res., 36, 1:145.